Regulon of CalR in Shewanella sp MR-7

Properties
Regulator type:	Transcription factor
TF locus tag:	Shewmr7_3151
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Utilization of aromatic compounds
Effector:
Regulog:	CalR - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - TetR
By pathway - Utilization of aromatic compounds

Regulated operons
	Locus Tag	Name	Function
Position: -78 Score: 7.2 Sequence: AACCGACTAATCAGTCGGTT Locus tag: Shewmr7_3150 Name: calB Funciton: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) Locus tag: Shewmr7_3151 Name: calR Funciton: Transcriptional regulator, TetR family
	Shewmr7_3150	calB	Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68)
	Shewmr7_3151	calR	Transcriptional regulator, TetR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD