Regulog CalR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Utilization of aromatic compounds |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - TetR
- By pathway - Utilization of aromatic compounds
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 2 | 1 |
| Shewanella putrefaciens CN-32 | 2 | 1 |
| Shewanella sp W3-18-1 | 2 | 1 |
| Shewanella sp ANA-3 | 2 | 1 |
| Shewanella sp MR-4 | 2 | 1 |
| Shewanella sp MR-7 | 2 | 1 |
| Shewanella baltica OS155 | 2 | 1 |
| Shewanella denitrificans OS217 | 2 | 1 |
| Shewanella frigidimarina NCIMB 400 | 2 | 1 |
| Shewanella amazonensis SB2B | 2 | 1 |
| Shewanella loihica PV-4 | 2 | 1 |
| Shewanella pealeana ATCC 700345 | 2 | 1 |
| Shewanella halifaxensis HAW-EB4 | 2 | 1 |
| Shewanella piezotolerans WP3 | 2 | 1 |
| Shewanella sediminis HAW-EB3 | 2 | 1 |
| Shewanella woodyi ATCC 51908 | 2 | 1 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| calB |
*
Shewanella oneidensis MR-1 Site: position = -78 score = 7.21699 sequence = AACCGACTAATCAGTCGGTT Gene: SO_3683: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella putrefaciens CN-32 Site: position = -104 score = 6.89353 sequence = AACCGACTAATCAGTCGGTA Gene: Sputcn32_2982: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella sp W3-18-1 Site: position = -104 score = 6.89353 sequence = AACCGACTAATCAGTCGGTA Gene: Sputw3181_0965: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella sp ANA-3 Site: position = -78 score = 7.21699 sequence = AACCGACTAATCAGTCGGTT Gene: Shewana3_3251: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella sp MR-4 Site: position = -78 score = 7.21699 sequence = AACCGACTAATCAGTCGGTT Gene: Shewmr4_0872: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella sp MR-7 Site: position = -78 score = 7.21699 sequence = AACCGACTAATCAGTCGGTT Gene: Shewmr7_3150: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella baltica OS155 Site: position = -125 score = 6.89353 sequence = AACCGACTAATCAGTCGGTA Gene: Sbal_3332: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella denitrificans OS217 Site: position = -45 score = 6.84078 sequence = ACCCGACTGATTAGTCGGTT Gene: Sden_0975: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella frigidimarina NCIMB 400 Site: position = -82 score = 7.08924 sequence = GACCGACTAATCAGTCGGTT Gene: Sfri_0937: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella amazonensis SB2B Site: position = -43 score = 7.08924 sequence = GACCGACTAATCAGTCGGTT Gene: Sama_2855: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella loihica PV-4 Site: position = -127 score = 7.08924 sequence = GACCGACTAATCAGTCGGTT Gene: Shew_3103: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella pealeana ATCC 700345 Site: position = -49 score = 7.08924 sequence = GACCGACTAATCAGTCGGTT Gene: Spea_3357: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella halifaxensis HAW-EB4 Site: position = -49 score = 6.96148 sequence = GACCGACTAATCAGTCGGTC Gene: Shal_3429: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella piezotolerans WP3 Site: position = -50 score = 7.08924 sequence = GACCGACTAATCAGTCGGTT Gene: swp_1052: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella sediminis HAW-EB3 Site: position = -203 score = 7.08924 sequence = GACCGACTAATCAGTCGGTT Gene: Ssed_3716: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
*
Shewanella woodyi ATCC 51908 Site: position = -77 score = 6.55484 sequence = GACCGACCAATCAGTCGGTT Gene: Swoo_4064: Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
Probable coniferyl aldehyde dehydrogenase (EC 1.2.1.68) |
| calR |
Gene: SO_3684: Transcriptional regulator, TetR family |
Gene: Sputcn32_2983: Transcriptional regulator, TetR family |
Gene: Sputw3181_0964: Transcriptional regulator, TetR family |
Gene: Shewana3_3252: Transcriptional regulator, TetR family |
Gene: Shewmr4_0871: Transcriptional regulator, TetR family |
Gene: Shewmr7_3151: Transcriptional regulator, TetR family |
Gene: Sbal_3333: Transcriptional regulator, TetR family |
Gene: Sden_0974: Transcriptional regulator, TetR family |
Gene: Sfri_0936: Transcriptional regulator, TetR family |
Gene: Sama_2856: Transcriptional regulator, TetR family |
Gene: Shew_3104: Transcriptional regulator, TetR family |
Gene: Spea_3358: Transcriptional regulator, TetR family |
Gene: Shal_3430: Transcriptional regulator, TetR family |
Gene: swp_1051: Transcriptional regulator, TetR family |
Gene: Ssed_3717: Transcriptional regulator, TetR family |
Gene: Swoo_4065: Transcriptional regulator, TetR family |
Transcriptional regulator, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |