Regulon of RER_29210 in Rhodococcus opacus B4

Properties
Regulator type:	Transcription factor
TF locus tag:	ROP_68690
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux
Effector:
Regulog:	RER_29210 - Nocardiaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Nocardiaceae
By TF family - GntR/Others
By pathway - Multidrug efflux

Regulated operons
	Locus Tag	Name	Function
Position: -21 Score: 5.2 Sequence: TTGTTTGCATAGAATGCAAACAT Locus tag: ROP_68690 Name: RER_29210 Funciton: Transcriptional regulator, GntR family Locus tag: ROP_68680 Name: SCO3813 Funciton: integral membrane protein
	ROP_68690	RER_29210	Transcriptional regulator, GntR family
	ROP_68680	SCO3813	integral membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD