Regulog RER_29210 - Nocardiaceae

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Multidrug efflux
Effector:
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Nocardia farcinica IFM 10152
Rhodococcus erythropolis PR4	2	1
Rhodococcus opacus B4	2	1
Rhodococcus sp. RHA1	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
RER_29210	Nocardia farcinica IFM 10152	* Rhodococcus erythropolis PR4 Site: position = -21 score = 5.19832 sequence = TTGTTTGCATAGAATGCAAACAT Gene: RER_29210: Transcriptional regulator, GntR family	* Rhodococcus opacus B4 Site: position = -21 score = 5.19832 sequence = TTGTTTGCATAGAATGCAAACAT Gene: ROP_68690: Transcriptional regulator, GntR family	* Rhodococcus sp. RHA1 Site: position = -21 score = 5.19832 sequence = TTGTTTGCATAGAATGCAAACAT Gene: RHA1_ro06890: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
SCO3813	Nocardia farcinica IFM 10152	Rhodococcus erythropolis PR4 Gene: RER_29200: integral membrane protein	Rhodococcus opacus B4 Gene: ROP_68680: integral membrane protein	Rhodococcus sp. RHA1 Gene: RHA1_ro06889: integral membrane protein	integral membrane protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --