Regulon of LndYR in Janibacter sp. HTCC2649

Properties
Regulator type:	Transcription factor
TF locus tag:	JNB_13093
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Antibiotic resistance
Effector:
Regulog:	LndYR - Micrococcineae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - GntR/Others
By pathway - Antibiotic resistance

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 5.7 Sequence: ATTGTGCTAGTTACCTAGTGGAAT Locus tag: JNB_13093 Name: lndYR Funciton: Transcriptional regulator of landomycin production, GntR family Locus tag: JNB_13088 Name: lndWA Funciton: Landomycin ABC transporter, ATP-binding protein Locus tag: JNB_13083 Name: lndWP Funciton: Landomycin ABC transporter, permease protein
	JNB_13093	lndYR	Transcriptional regulator of landomycin production, GntR family
	JNB_13088	lndWA	Landomycin ABC transporter, ATP-binding protein
	JNB_13083	lndWP	Landomycin ABC transporter, permease protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD