Regulog LndYR - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Antibiotic resistance |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - GntR/Others
- By pathway - Antibiotic resistance
| Genome | Genes | Operons |
|---|---|---|
| Arthrobacter aurescens TC1 | ||
| Arthrobacter chlorophenolicus A6 | ||
| Arthrobacter sp. FB24 | ||
| Beutenbergia cavernae DSM 12333 | 3 | 1 |
| Brachybacterium faecium DSM 4810 | ||
| Brevibacterium linens BL2 | ||
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Janibacter sp. HTCC2649 | 3 | 1 |
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | ||
| Kytococcus sedentarius DSM 20547 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Tropheryma whipplei str. Twist |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| lndYR |
|
|
|
*
Beutenbergia cavernae DSM 12333 Site: position = -40 score = 4.84883 sequence = CTTGTACTATCTTCTTAGTGGAAC Gene: Bcav_0983: Transcriptional regulator of landomycin production, GntR family |
|
|
|
*
Janibacter sp. HTCC2649 Site: position = -84 score = 5.7459 sequence = ATTGTGCTAGTTACCTAGTGGAAT Gene: JNB_13093: Transcriptional regulator of landomycin production, GntR family |
|
|
|
|
|
|
Transcriptional regulator of landomycin production, GntR family |
| lndWA |
|
|
|
Gene: Bcav_0982: Landomycin ABC transporter, ATP-binding protein |
|
|
|
Gene: JNB_13088: Landomycin ABC transporter, ATP-binding protein |
|
|
|
|
|
|
Landomycin ABC transporter, ATP-binding protein |
| lndWP |
|
|
|
Gene: Bcav_0981: Landomycin ABC transporter, permease protein |
|
|
|
Gene: JNB_13083: Landomycin ABC transporter, permease protein |
|
|
|
|
|
|
Landomycin ABC transporter, permease protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |