Profile of regulator LndYR in Micrococcineae
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Antibiotic resistance |
| Effector: | |
| Regulog: | LndYR - Micrococcineae |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - GntR/Others
- By pathway - Antibiotic resistance
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Beutenbergia cavernae DSM 12333 | |||||
| Bcav_0983 | lndYR | -40 | 4.8 | CTTGTACTATCTTCTTAGTGGAAC | |
| Janibacter sp. HTCC2649 | |||||
| JNB_13093 | lndYR | -84 | 5.7 | ATTGTGCTAGTTACCTAGTGGAAT | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |