Regulon of AAur_3503 in Arthrobacter aurescens TC1

Properties
Regulator type:	Transcription factor
TF locus tag:	AAur_3503
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	AAur_3503 - Micrococcineae
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -163 Score: 6.8 Sequence: CTTTGGAATCGATTCCACGG Position: -118 Score: 6.6 Sequence: ATTTGGAATCGATTCCACGA Locus tag: AAur_3501 Name: AAur_3501 Funciton: Putative sugar ABC transporter, solute-binding domain protein Locus tag: AAur_3500 Name: Aaur_3500 Funciton: Putative sugar ABC transporter, permease protein Locus tag: AAur_3499 Name: Aaur_3499 Funciton: Putative sugar ABC transporter, permease component Locus tag: AAur_3498 Name: AAur_3498 Funciton: putative sugar oxidoreductase Locus tag: AAur_3497 Name: thuA Funciton: Trehalose utilization protein
	AAur_3501	AAur_3501	Putative sugar ABC transporter, solute-binding domain protein
	AAur_3500	Aaur_3500	Putative sugar ABC transporter, permease protein
	AAur_3499	Aaur_3499	Putative sugar ABC transporter, permease component
	AAur_3498	AAur_3498	putative sugar oxidoreductase
	AAur_3497	thuA	Trehalose utilization protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD