Regulog AAur_3503 - Micrococcineae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Micrococcineae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Clavibacter michiganensis subsp. michiganensis NCPPB 382 | ||
| Arthrobacter aurescens TC1 | 5 | 1 |
| Arthrobacter chlorophenolicus A6 | ||
| Arthrobacter sp. FB24 | 6 | 1 |
| Beutenbergia cavernae DSM 12333 | ||
| Brachybacterium faecium DSM 4810 | ||
| Brevibacterium linens BL2 | ||
| Janibacter sp. HTCC2649 | ||
| Jonesia denitrificans DSM 20603 | ||
| Kocuria rhizophila DC2201 | ||
| Tropheryma whipplei str. Twist | ||
| Renibacterium salmoninarum ATCC 33209 | ||
| Leifsonia xyli subsp. xyli str. CTCB07 | ||
| Kytococcus sedentarius DSM 20547 |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| AAur_3501 |
|
*
Arthrobacter aurescens TC1 Site: position = -163 score = 6.83358 sequence = CTTTGGAATCGATTCCACGG Site: position = -118 score = 6.58232 sequence = ATTTGGAATCGATTCCACGA Gene: AAur_3501: Putative sugar ABC transporter, solute-binding domain protein |
|
*
Arthrobacter sp. FB24 Site: position = -162 score = 7.00979 sequence = CTTTGGAATCGATTCCACAG Site: position = -117 score = 7.00031 sequence = TTTTGGAATCGATTCCAAAA Gene: Arth_3687: Putative sugar ABC transporter, solute-binding domain protein |
|
|
|
|
|
|
|
|
|
|
Putative sugar ABC transporter, solute-binding domain protein |
| Aaur_3500 |
|
Gene: AAur_3500: Putative sugar ABC transporter, permease protein |
|
Gene: Arth_3686: Putative sugar ABC transporter, permease protein |
|
|
|
|
|
|
|
|
|
|
Putative sugar ABC transporter, permease protein |
| Aaur_3499 |
|
Gene: AAur_3499: Putative sugar ABC transporter, permease component |
|
Gene: Arth_3685: Putative sugar ABC transporter, permease component |
|
|
|
|
|
|
|
|
|
|
Putative sugar ABC transporter, permease component |
| AAur_3498 |
|
Gene: AAur_3498: putative sugar oxidoreductase |
|
Gene: Arth_3684: putative sugar oxidoreductase |
|
|
|
|
|
|
|
|
|
|
putative sugar oxidoreductase |
| thuA |
|
Gene: AAur_3497: Trehalose utilization protein |
|
Gene: Arth_3683: Trehalose utilization protein |
|
|
|
|
|
|
|
|
|
|
Trehalose utilization protein |
| AAur_0716 |
|
|
|
Gene: Arth_3682: oxidoreductase domain protein |
|
|
|
|
|
|
|
|
|
|
putative myo-inositol 2-dehydrogenase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |