Profile of regulator AAur_3503 in Micrococcineae

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	AAur_3503 - Micrococcineae

Member of regulog collections

By taxonomy - Micrococcineae
By TF family - LacI
By pathway - Sugar utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Arthrobacter aurescens TC1
	AAur_3501	AAur_3501	-163	6.8	CTTTGGAATCGATTCCACGG
	AAur_3501	AAur_3501	-118	6.6	ATTTGGAATCGATTCCACGA
Arthrobacter sp. FB24
	Arth_3687	AAur_3501	-162	7	CTTTGGAATCGATTCCACAG
	Arth_3687	AAur_3501	-117	7	TTTTGGAATCGATTCCAAAA

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD