Regulon of CelR3 in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_16482
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Cellobiose utilization
Effector:	Cellobiose-6-phosphate
Regulog:	CelR3 - Vibrionales
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Cellobiose-6-phosphate
By pathway - Cellobiose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -56 Score: 5 Sequence: TTTGGGAAACGGTTTCCCAA Locus tag: VSAK1_16482 Name: celR3 Funciton: Transcriptional regulator of cellobiose utilization, LacI family
	VSAK1_16482	celR3	Transcriptional regulator of cellobiose utilization, LacI family
Position: -73 Score: 6.4 Sequence: TTTGGAAATCGGTTTCCAAA Locus tag: VSAK1_16467 Name: celB2 Funciton: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) Locus tag: VSAK1_16472 Name: celD2 Funciton: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) Locus tag: VSAK1_16477 Name: celA2 Funciton: PTS system, cellobiose-specific IIA component (EC 2.7.1.69)
	VSAK1_16467	celB2	PTS system, cellobiose-specific IIB component (EC 2.7.1.69)
	VSAK1_16472	celD2	PTS system, cellobiose-specific IIC component (EC 2.7.1.69)
	VSAK1_16477	celA2	PTS system, cellobiose-specific IIA component (EC 2.7.1.69)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD