Regulog CelR3 - Vibrionales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Cellobiose utilization |
| Effector: | Cellobiose-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By effector - Cellobiose-6-phosphate
- By pathway - Cellobiose utilization
| Genome | Genes | Operons |
|---|---|---|
| Photobacterium profundum SS9 | 4 | 1 |
| Vibrio angustum S14 | ||
| Vibrio vulnificus CMCP6 | ||
| Vibrio splendidus LGP32 | ||
| Vibrio shilonii AK1 | 4 | 2 |
| Vibrio salmonicida LFI1238 | ||
| Vibrio parahaemolyticus RIMD 2210633 | ||
| Vibrio harveyi ATCC BAA-1116 | ||
| Vibrio fischeri ES114 | ||
| Vibrio cholerae O1 biovar eltor str. N16961 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| celB2 |
*
Photobacterium profundum SS9 Site: position = -19 score = 6.04952 sequence = TACGGAAACCGGTTTCCATT Gene: PBPRB2008: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
|
|
|
*
Vibrio shilonii AK1 Site: position = -73 score = 6.41242 sequence = TTTGGAAATCGGTTTCCAAA Gene: VSAK1_16467: PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
|
|
|
|
|
PTS system, cellobiose-specific IIB component (EC 2.7.1.69) |
| celD2 |
Gene: PBPRB2007: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
|
|
Gene: VSAK1_16472: PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
|
|
|
|
|
PTS system, cellobiose-specific IIC component (EC 2.7.1.69) |
| celH |
Gene: PBPRB2006: Beta-glucosidase (EC 3.2.1.21) |
|
|
|
|
|
|
|
|
|
Beta-glucosidase (EC 3.2.1.21) |
| celA2 |
Gene: PBPRB2005: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
|
|
Gene: VSAK1_16477: PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
|
|
|
|
|
PTS system, cellobiose-specific IIA component (EC 2.7.1.69) |
| CRON 2. | |||||||||||
| celR3 |
Gene: PBPRB2003: Transcriptional regulator of cellobiose utilization, LacI family |
|
|
|
*
Vibrio shilonii AK1 Site: position = -56 score = 5.03062 sequence = TTTGGGAAACGGTTTCCCAA Gene: VSAK1_16482: Transcriptional regulator of cellobiose utilization, LacI family |
|
|
|
|
|
Transcriptional regulator of cellobiose utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |