Regulon of Bphy_2245 in Burkholderia xenovorans LB400

Properties
Regulator type:	Transcription factor
TF locus tag:	Bxe_A3676
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bphy_2245 - Burkholderia
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -143 Score: 7.6 Sequence: AAATGTAATCGATTACATTT Locus tag: Bxe_A3676 Name: Bphy_2245 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: Bxe_A3675 Name: Bphy_2244 Funciton: Monosaccharide ABC transporter, permease protein Locus tag: Bxe_A3674 Name: Bphy_2243 Funciton: Monosaccharide ABC transporter, ATP-binding protein Locus tag: Bxe_A3673 Name: Bphy_2242 Funciton: Monosaccharide ABC transporter, substrate-binding protein Locus tag: Bxe_A3672 Name: Bphy_2241 Funciton: Predicted sugar isomerase Locus tag: Bxe_A3671 Name: Bphy_2240 Funciton: Predicted sugar oxidoreductase
	Bxe_A3676	Bphy_2245	Predicted sugar utilization transcriptional regulator, LacI family
	Bxe_A3675	Bphy_2244	Monosaccharide ABC transporter, permease protein
	Bxe_A3674	Bphy_2243	Monosaccharide ABC transporter, ATP-binding protein
	Bxe_A3673	Bphy_2242	Monosaccharide ABC transporter, substrate-binding protein
	Bxe_A3672	Bphy_2241	Predicted sugar isomerase
	Bxe_A3671	Bphy_2240	Predicted sugar oxidoreductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD