Profile of regulator Bphy_2245 in Burkholderia

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bphy_2245 - Burkholderia

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Burkholderia phymatum STM815
	Bphy_2245	Bphy_2245	-107	7.4	GAATGTAATCGATTACATTT
Burkholderia xenovorans LB400
	Bxe_A3676	Bphy_2245	-143	7.6	AAATGTAATCGATTACATTT

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD