Regulog Bphy_2245 - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia cepacia AMMD | ||
| Burkholderia glumae BGR1 | ||
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia phymatum STM815 | 6 | 1 |
| Burkholderia pseudomallei K96243 | ||
| Burkholderia sp. 383 | ||
| Burkholderia vietnamiensis G4 | ||
| Burkholderia xenovorans LB400 | 6 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| Bphy_2245 |
|
|
|
*
Burkholderia phymatum STM815 Site: position = -107 score = 7.42686 sequence = GAATGTAATCGATTACATTT Gene: Bphy_2245: Predicted sugar utilization transcriptional regulator, LacI family |
|
|
|
*
Burkholderia xenovorans LB400 Site: position = -143 score = 7.60951 sequence = AAATGTAATCGATTACATTT Gene: Bxe_A3676: Predicted sugar utilization transcriptional regulator, LacI family |
Predicted sugar utilization transcriptional regulator, LacI family |
| Bphy_2244 |
|
|
|
Gene: Bphy_2244: Monosaccharide ABC transporter, permease protein |
|
|
|
Gene: Bxe_A3675: Monosaccharide ABC transporter, permease protein |
Monosaccharide ABC transporter, permease protein |
| Bphy_2243 |
|
|
|
Gene: Bphy_2243: Monosaccharide ABC transporter, ATP-binding protein |
|
|
|
Gene: Bxe_A3674: Monosaccharide ABC transporter, ATP-binding protein |
Monosaccharide ABC transporter, ATP-binding protein |
| Bphy_2242 |
|
|
|
Gene: Bphy_2242: Monosaccharide ABC transporter, substrate-binding protein |
|
|
|
Gene: Bxe_A3673: Monosaccharide ABC transporter, substrate-binding protein |
Monosaccharide ABC transporter, substrate-binding protein |
| Bphy_2241 |
|
|
|
Gene: Bphy_2241: Predicted sugar isomerase |
|
|
|
Gene: Bxe_A3672: Predicted sugar isomerase |
Predicted sugar isomerase |
| Bphy_2240 |
|
|
|
Gene: Bphy_2240: Predicted sugar oxidoreductase |
|
|
|
Gene: Bxe_A3671: Predicted sugar oxidoreductase |
Predicted sugar oxidoreductase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |