Regulon of SCO1956 in Streptomyces coelicolor A3(2)

Properties
Regulator type:	Transcription factor
TF locus tag:	SCO1956
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	SCO1956 - Streptomycetaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptomycetaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 7.7 Sequence: AAACGCTTGCGCAAGCGTTT Locus tag: SCO1956 Name: SCO1956 Funciton: Transcriptional regulator, LacI family Locus tag: SCO1957 Name: scrK Funciton: Fructokinase (EC 2.7.1.4)
	SCO1956	SCO1956	Transcriptional regulator, LacI family
	SCO1957	scrK	Fructokinase (EC 2.7.1.4)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD