Regulog SCO1956 - Streptomycetaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptomycetaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Streptomyces scabiei 87.22 | ||
| Streptomyces griseus subsp. griseus NBRC 13350 | ||
| Streptomyces coelicolor A3(2) | 2 | 1 |
| Streptomyces avermitilis MA-4680 | 2 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| SCO1956 |
|
|
*
Streptomyces coelicolor A3(2) Site: position = -85 score = 7.74597 sequence = AAACGCTTGCGCAAGCGTTT Gene: SCO1956: Transcriptional regulator, LacI family |
*
Streptomyces avermitilis MA-4680 Site: position = -100 score = 7.74597 sequence = AAACGCTTGCGCAAGCGTTT Gene: SAV_6288: Transcriptional regulator, LacI family |
Transcriptional regulator, LacI family |
| scrK |
Gene: SCAB_69581: Fructokinase (EC 2.7.1.4) |
|
Gene: SCO1957: Fructokinase (EC 2.7.1.4) |
Gene: SAV_6287: Fructokinase (EC 2.7.1.4) |
Fructokinase (EC 2.7.1.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |