Regulog SCO1956 - Streptomycetaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Actinobacteria
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Streptomyces scabiei 87.22
Streptomyces griseus subsp. griseus NBRC 13350
Streptomyces coelicolor A3(2)	2	1
Streptomyces avermitilis MA-4680	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
SCO1956	Streptomyces scabiei 87.22	Streptomyces griseus subsp. griseus NBRC 13350	* Streptomyces coelicolor A3(2) Site: position = -85 score = 7.74597 sequence = AAACGCTTGCGCAAGCGTTT Gene: SCO1956: Transcriptional regulator, LacI family	* Streptomyces avermitilis MA-4680 Site: position = -100 score = 7.74597 sequence = AAACGCTTGCGCAAGCGTTT Gene: SAV_6288: Transcriptional regulator, LacI family	Transcriptional regulator, LacI family
scrK	Streptomyces scabiei 87.22 Gene: SCAB_69581: Fructokinase (EC 2.7.1.4)	Streptomyces griseus subsp. griseus NBRC 13350	Streptomyces coelicolor A3(2) Gene: SCO1957: Fructokinase (EC 2.7.1.4)	Streptomyces avermitilis MA-4680 Gene: SAV_6287: Fructokinase (EC 2.7.1.4)	Fructokinase (EC 2.7.1.4)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --