Regulon of Bphy_6994 in Burkholderia sp. 383

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep18194_B1311
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	NULL
Effector:
Regulog:	Bphy_6994 - Burkholderia
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - NULL

Regulated operons
	Locus Tag	Name	Function
Position: -65 Score: 6.6 Sequence: TTACTGTATCGATACACTAA Locus tag: Bcep18194_B1309 Name: Bphy_6992 Funciton: Putative TRAP transporter, periplasmic protein Locus tag: Bcep18194_B1310 Name: Bphy_6993 Funciton: Putative TRAP transporter, permease protein Locus tag: Bcep18194_B1311 Name: Bphy_6994 Funciton: Predicted transcriptional regulator, LacI family Locus tag: Bcep18194_B1312 Name: PF00389 Funciton: Putative phosphoglycerate dehydrogenase Locus tag: Bcep18194_B1313 Name: PF04909 Funciton: Amidohydrolase 2
	Bcep18194_B1309	Bphy_6992	Putative TRAP transporter, periplasmic protein
	Bcep18194_B1310	Bphy_6993	Putative TRAP transporter, permease protein
	Bcep18194_B1311	Bphy_6994	Predicted transcriptional regulator, LacI family
	Bcep18194_B1312	PF00389	Putative phosphoglycerate dehydrogenase
	Bcep18194_B1313	PF04909	Amidohydrolase 2

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD