Regulog Bphy_6994 - Burkholderia
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | NULL |
| Effector: | |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Burkholderia
- By TF family - LacI
- By pathway - NULL
| Genome | Genes | Operons |
|---|---|---|
| Burkholderia cepacia AMMD | ||
| Burkholderia glumae BGR1 | ||
| Burkholderia mallei ATCC 23344 | ||
| Burkholderia phymatum STM815 | 5 | 1 |
| Burkholderia pseudomallei K96243 | ||
| Burkholderia sp. 383 | 5 | 1 |
| Burkholderia vietnamiensis G4 | ||
| Burkholderia xenovorans LB400 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| Bphy_6992 |
|
|
|
*
Burkholderia phymatum STM815 Site: position = -101 score = 6.60711 sequence = TTACTGTATCGATACACTAA Gene: Bphy_6992: Putative TRAP transporter, periplasmic protein |
|
*
Burkholderia sp. 383 Site: position = -65 score = 6.60711 sequence = TTACTGTATCGATACACTAA Gene: Bcep18194_B1309: Putative TRAP transporter, periplasmic protein |
|
|
Putative TRAP transporter, periplasmic protein |
| Bphy_6993 |
|
|
|
Gene: Bphy_6993: Putative TRAP transporter, permease protein |
|
Gene: Bcep18194_B1310: Putative TRAP transporter, permease protein |
|
|
Putative TRAP transporter, permease protein |
| Bphy_6994 |
|
|
|
Gene: Bphy_6994: Predicted transcriptional regulator, LacI family |
|
Gene: Bcep18194_B1311: Predicted transcriptional regulator, LacI family |
|
|
Predicted transcriptional regulator, LacI family |
| PF00389 |
|
|
|
Gene: Bphy_6995: Putative phosphoglycerate dehydrogenase |
|
Gene: Bcep18194_B1312: Putative phosphoglycerate dehydrogenase |
|
|
Putative phosphoglycerate dehydrogenase |
| PF04909 |
|
|
|
Gene: Bphy_6996: Amidohydrolase 2 |
|
Gene: Bcep18194_B1313: Amidohydrolase 2 |
|
|
Amidohydrolase 2 |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |