Profile of regulator Bphy_6994 in Burkholderia

Properties
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	NULL
Effector:
Regulog:	Bphy_6994 - Burkholderia

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - NULL

Transcription factor binding sites

	Locus Tag	Name	Position	Score	Sequence
Burkholderia phymatum STM815
	Bphy_6992	Bphy_6992	-101	6.6	TTACTGTATCGATACACTAA
Burkholderia sp. 383
	Bcep18194_B1309	Bphy_6992	-65	6.6	TTACTGTATCGATACACTAA

Export
	Regulatory Sites	[ FASTA format ]	DOWNLOAD