Regulon of MalI in Vibrio salmonicida LFI1238

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAL_I1618
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Maltose utilization
Effector:
Regulog:	MalI - Vibrionales
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 15 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By pathway - Maltose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 6.4 Sequence: TTGGTAAAACGTTTTATCAA Position: -40 Score: 6.7 Sequence: TAGGTAAAACGTTTTATCTA Locus tag: VSAL_I1618 Name: malI Funciton: Maltose regulon regulatory protein MalI
	VSAL_I1618	malI	Maltose regulon regulatory protein MalI

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD