Regulog MalI - Vibrionales

Member of regulog collections
- By taxonomy - Vibrionales
- By TF family - LacI
- By pathway - Maltose utilization
Genome | Genes | Operons |
---|---|---|
Vibrio angustum S14 | 3 | 2 |
Photobacterium profundum SS9 | ||
Vibrio cholerae O1 biovar eltor str. N16961 | ||
Vibrio fischeri ES114 | 3 | 2 |
Vibrio harveyi ATCC BAA-1116 | ||
Vibrio parahaemolyticus RIMD 2210633 | ||
Vibrio salmonicida LFI1238 | 1 | 1 |
Vibrio shilonii AK1 | 3 | 2 |
Vibrio splendidus LGP32 | ||
Vibrio vulnificus CMCP6 |
Genes | Function | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||
malI |
*
Vibrio angustum S14 Site: position = -245 score = 6.00058 sequence = GTGGTAAAACGTTTTATCAC Site: position = -153 score = 6.59652 sequence = ATGATAAAACGTTTTATCAA Site: position = -51 score = 5.79811 sequence = TAGATATAACGTTTTATATT Gene: VAS14_19066: Maltose regulon regulatory protein MalI |
|
|
*
Vibrio fischeri ES114 Site: position = -140 score = 6.14881 sequence = ATGGTAAAACGTTTTACCAC Site: position = -40 score = 6.21316 sequence = TAGGTGAAACGTTTTATCAA Gene: VF_1720: Maltose regulon regulatory protein MalI |
|
|
*
Vibrio salmonicida LFI1238 Site: position = -139 score = 6.44179 sequence = TTGGTAAAACGTTTTATCAA Site: position = -40 score = 6.65851 sequence = TAGGTAAAACGTTTTATCTA Gene: VSAL_I1618: Maltose regulon regulatory protein MalI |
*
Vibrio shilonii AK1 Site: position = -134 score = 6.55534 sequence = TTGATAAAACGTTTTATCAA Site: position = -34 score = 5.96474 sequence = TTGATAAAACGTTTTTCCTA Gene: VSAK1_23534: Maltose regulon regulatory protein MalI |
|
|
Maltose regulon regulatory protein MalI |
CRON 2. | |||||||||||
malX |
*
Vibrio angustum S14 Site: position = -153 score = 6.59652 sequence = TTGATAAAACGTTTTATCAT Site: position = -61 score = 6.00058 sequence = GTGATAAAACGTTTTACCAC Gene: VAS14_19061: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
|
|
*
Vibrio fischeri ES114 Site: position = -228 score = 6.21316 sequence = TTGATAAAACGTTTCACCTA Site: position = -128 score = 6.14881 sequence = GTGGTAAAACGTTTTACCAT Gene: VF_1719: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
|
|
Gene: VSAL_I1615: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
*
Vibrio shilonii AK1 Site: position = -122 score = 6.55534 sequence = TTGATAAAACGTTTTATCAA Site: position = -222 score = 5.96474 sequence = TAGGAAAAACGTTTTATCAA Gene: VSAK1_23539: PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
|
|
PTS system, maltose and glucose-specific IIC component (EC 2.7.1.69) / PTS system, maltose and glucose-specific IIB component (EC 2.7.1.69) |
malY |
Gene: VAS14_19056: Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
|
|
Gene: VF_1718: Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
|
|
Gene: VSAL_I1614: Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
Gene: VSAK1_23544: Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
|
|
Cystathionine beta-lyase (EC 4.4.1.8) / Maltose regulon modulator |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |