Regulon of IolR in Anaerocellum thermophilum DSM 6725

Properties
Regulator type:	Transcription factor
TF locus tag:	Athe_0343
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Inositol utilization
Effector:
Regulog:	IolR - Thermoanaerobacterales
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Thermoanaerobacterales
By TF family - LacI
By pathway - Inositol utilization

Regulated operons
	Locus Tag	Name	Function
Position: -72 Score: 5 Sequence: CATTGTAATTGATTACACTA Position: -38 Score: 6.1 Sequence: ATATGTAATCAATTACACAA Locus tag: Athe_0344 Name: iolG3 Funciton: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) Locus tag: Athe_0345 Name: iolI Funciton: Inosose isomerase (EC 5.3.99.-)
	Athe_0344	iolG3	Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
	Athe_0345	iolI	Inosose isomerase (EC 5.3.99.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD