Statistics of regulated genes

Genome	Genes	Operons
Thermoanaerobacter tengcongensis MB4	7	1
Thermoanaerobacter italicus Ab9	6	1
Thermoanaerobacter ethanolicus X514	7	1
Moorella thermoacetica ATCC 39073
Carboxydothermus hydrogenoformans Z-2901
Caldicellulosiruptor saccharolyticus DSM 8903	2	1
Anaerocellum thermophilum DSM 6725	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes								Function
CRON 1.
iolR	* Thermoanaerobacter tengcongensis MB4 Site: position = -30 score = 6.16229 sequence = TTATGTAATCTGTTACATAG Gene: TTE1952: Predicted inositol utilization transcriptional regulator IolR, LacI family	* Thermoanaerobacter italicus Ab9 Site: position = -29 score = 6.01275 sequence = TTATGTAATCTGTTACACAG Gene: Thit_1753: Predicted inositol utilization transcriptional regulator IolR, LacI family	* Thermoanaerobacter ethanolicus X514 Site: position = -118 score = 4.69521 sequence = CTATGGGAGTGCTTAAATAC Gene: Teth514_1072: Predicted inositol utilization transcriptional regulator IolR, LacI family	Moorella thermoacetica ATCC 39073	Carboxydothermus hydrogenoformans Z-2901	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_1171: Predicted inositol utilization transcriptional regulator IolR, LacI family	Anaerocellum thermophilum DSM 6725 Gene: Athe_0343: Predicted inositol utilization transcriptional regulator IolR, LacI family	Predicted inositol utilization transcriptional regulator IolR, LacI family
iolG2	Thermoanaerobacter tengcongensis MB4 Gene: TTE1951: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)	Thermoanaerobacter italicus Ab9 Gene: Thit_1752: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1073: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)	Moorella thermoacetica ATCC 39073	Carboxydothermus hydrogenoformans Z-2901	Caldicellulosiruptor saccharolyticus DSM 8903	Anaerocellum thermophilum DSM 6725	Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18)
iolG1	Thermoanaerobacter tengcongensis MB4 Gene: TTE1950: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)	Thermoanaerobacter italicus Ab9 Gene: Thit_1751: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1074: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)	Moorella thermoacetica ATCC 39073	Carboxydothermus hydrogenoformans Z-2901	Caldicellulosiruptor saccharolyticus DSM 8903	Anaerocellum thermophilum DSM 6725	Myo-inositol 2-dehydrogenase (EC 1.1.1.18)
iolE	Thermoanaerobacter tengcongensis MB4 Gene: TTE1949: Inosose dehydratase (EC 4.2.1.44)	Thermoanaerobacter italicus Ab9 Gene: Thit_1750: Inosose dehydratase (EC 4.2.1.44)	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1075: Inosose dehydratase (EC 4.2.1.44)	Moorella thermoacetica ATCC 39073	Carboxydothermus hydrogenoformans Z-2901	Caldicellulosiruptor saccharolyticus DSM 8903	Anaerocellum thermophilum DSM 6725	Inosose dehydratase (EC 4.2.1.44)
iolI	Thermoanaerobacter tengcongensis MB4 Gene: TTE1948: Inosose isomerase (EC 5.3.99.-)	Thermoanaerobacter italicus Ab9 Gene: Thit_1749: Inosose isomerase (EC 5.3.99.-)	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1076: Inosose isomerase (EC 5.3.99.-)	Moorella thermoacetica ATCC 39073	Carboxydothermus hydrogenoformans Z-2901	Caldicellulosiruptor saccharolyticus DSM 8903 Gene: Csac_1173: Inosose isomerase (EC 5.3.99.-)	Anaerocellum thermophilum DSM 6725 Gene: Athe_0345: Inosose isomerase (EC 5.3.99.-)	Inosose isomerase (EC 5.3.99.-)
iolT	Thermoanaerobacter tengcongensis MB4 Gene: TTE1947: Putative myo-inositol transporter	Thermoanaerobacter italicus Ab9	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1077: Putative myo-inositol transporter	Moorella thermoacetica ATCC 39073	Carboxydothermus hydrogenoformans Z-2901	Caldicellulosiruptor saccharolyticus DSM 8903	Anaerocellum thermophilum DSM 6725	Putative myo-inositol transporter
gyaR	Thermoanaerobacter tengcongensis MB4 Gene: TTE1946: Putative glyoxylate reductase (EC 1.1.1.26)	Thermoanaerobacter italicus Ab9 Gene: Thit_1748: Putative glyoxylate reductase (EC 1.1.1.26)	Thermoanaerobacter ethanolicus X514 Gene: Teth514_1078: Putative glyoxylate reductase (EC 1.1.1.26)	Moorella thermoacetica ATCC 39073	Carboxydothermus hydrogenoformans Z-2901	Caldicellulosiruptor saccharolyticus DSM 8903	Anaerocellum thermophilum DSM 6725	Putative glyoxylate reductase (EC 1.1.1.26)
iolG3	Thermoanaerobacter tengcongensis MB4	Thermoanaerobacter italicus Ab9	Thermoanaerobacter ethanolicus X514	Moorella thermoacetica ATCC 39073	Carboxydothermus hydrogenoformans Z-2901	* Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -38 score = 5.99236 sequence = TTATGTAATCAATTACACTA Site: position = -72 score = 4.78082 sequence = CGTTGTAATTGATTACACTA Gene: Csac_1172: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)	* Anaerocellum thermophilum DSM 6725 Site: position = -72 score = 5.0022 sequence = CATTGTAATTGATTACACTA Site: position = -38 score = 6.09944 sequence = ATATGTAATCAATTACACAA Gene: Athe_0344: Myo-inositol 2-dehydrogenase (EC 1.1.1.18)	Myo-inositol 2-dehydrogenase (EC 1.1.1.18)

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD