Regulog IolR - Thermoanaerobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Inositol utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Thermoanaerobacterales
- By TF family - LacI
- By pathway - Inositol utilization
| Genome | Genes | Operons |
|---|---|---|
| Thermoanaerobacter tengcongensis MB4 | 7 | 1 |
| Thermoanaerobacter italicus Ab9 | 6 | 1 |
| Thermoanaerobacter ethanolicus X514 | 7 | 1 |
| Moorella thermoacetica ATCC 39073 | ||
| Carboxydothermus hydrogenoformans Z-2901 | ||
| Caldicellulosiruptor saccharolyticus DSM 8903 | 2 | 1 |
| Anaerocellum thermophilum DSM 6725 | 2 | 1 |
| Genes | Function | |||||||
|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||
| iolR |
*
Thermoanaerobacter tengcongensis MB4 Site: position = -30 score = 6.16229 sequence = TTATGTAATCTGTTACATAG Gene: TTE1952: Predicted inositol utilization transcriptional regulator IolR, LacI family |
*
Thermoanaerobacter italicus Ab9 Site: position = -29 score = 6.01275 sequence = TTATGTAATCTGTTACACAG Gene: Thit_1753: Predicted inositol utilization transcriptional regulator IolR, LacI family |
*
Thermoanaerobacter ethanolicus X514 Site: position = -118 score = 4.69521 sequence = CTATGGGAGTGCTTAAATAC Gene: Teth514_1072: Predicted inositol utilization transcriptional regulator IolR, LacI family |
|
|
Gene: Csac_1171: Predicted inositol utilization transcriptional regulator IolR, LacI family |
Gene: Athe_0343: Predicted inositol utilization transcriptional regulator IolR, LacI family |
Predicted inositol utilization transcriptional regulator IolR, LacI family |
| iolG2 |
Gene: TTE1951: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
Gene: Thit_1752: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
Gene: Teth514_1073: Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
|
|
|
|
Myo-inositol 2-dehydrogenase 1 (EC 1.1.1.18) |
| iolG1 |
Gene: TTE1950: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
Gene: Thit_1751: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
Gene: Teth514_1074: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
|
|
|
|
Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
| iolE |
Gene: TTE1949: Inosose dehydratase (EC 4.2.1.44) |
Gene: Thit_1750: Inosose dehydratase (EC 4.2.1.44) |
Gene: Teth514_1075: Inosose dehydratase (EC 4.2.1.44) |
|
|
|
|
Inosose dehydratase (EC 4.2.1.44) |
| iolI |
Gene: TTE1948: Inosose isomerase (EC 5.3.99.-) |
Gene: Thit_1749: Inosose isomerase (EC 5.3.99.-) |
Gene: Teth514_1076: Inosose isomerase (EC 5.3.99.-) |
|
|
Gene: Csac_1173: Inosose isomerase (EC 5.3.99.-) |
Gene: Athe_0345: Inosose isomerase (EC 5.3.99.-) |
Inosose isomerase (EC 5.3.99.-) |
| iolT |
Gene: TTE1947: Putative myo-inositol transporter |
|
Gene: Teth514_1077: Putative myo-inositol transporter |
|
|
|
|
Putative myo-inositol transporter |
| gyaR |
Gene: TTE1946: Putative glyoxylate reductase (EC 1.1.1.26) |
Gene: Thit_1748: Putative glyoxylate reductase (EC 1.1.1.26) |
Gene: Teth514_1078: Putative glyoxylate reductase (EC 1.1.1.26) |
|
|
|
|
Putative glyoxylate reductase (EC 1.1.1.26) |
| iolG3 |
|
|
|
|
|
*
Caldicellulosiruptor saccharolyticus DSM 8903 Site: position = -38 score = 5.99236 sequence = TTATGTAATCAATTACACTA Site: position = -72 score = 4.78082 sequence = CGTTGTAATTGATTACACTA Gene: Csac_1172: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
*
Anaerocellum thermophilum DSM 6725 Site: position = -72 score = 5.0022 sequence = CATTGTAATTGATTACACTA Site: position = -38 score = 6.09944 sequence = ATATGTAATCAATTACACAA Gene: Athe_0344: Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
Myo-inositol 2-dehydrogenase (EC 1.1.1.18) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |