Regulon of Bphy_4590 in Burkholderia sp. 383

Properties
Regulator type:	Transcription factor
TF locus tag:	Bcep18194_C7624
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bphy_4590 - Burkholderia
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -237 Score: 6.8 Sequence: GAATGTAATCGCTTACATTT Locus tag: Bcep18194_C7624 Name: Bphy_4590 Funciton: Predicted transcriptional regulator, LacI family
	Bcep18194_C7624	Bphy_4590	Predicted transcriptional regulator, LacI family
Position: -24 Score: 6.8 Sequence: AAATGTAAGCGATTACATTC Locus tag: Bcep18194_C7623 Name: Bphy_4591 Funciton: Predicted sugar kinase Locus tag: Bcep18194_C7622 Name: Bphy_4592 Funciton: Predicted sugar transporter Locus tag: Bcep18194_C7621 Name: COG0329 Funciton: predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein
	Bcep18194_C7623	Bphy_4591	Predicted sugar kinase
	Bcep18194_C7622	Bphy_4592	Predicted sugar transporter
	Bcep18194_C7621	COG0329	predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD