Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Profile of regulator Bphy_4590 in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Bphy_4590 - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia cepacia AMMD
Bamb_1342 Bphy_4590 -237 6.7 GAATGTAACCGCTTACATTT
Bamb_1343 Bphy_4591 -21 6.7 AAATGTAAGCGGTTACATTC
Burkholderia glumae BGR1
bglu_2g08900 Bphy_4591 -49 6.1 AAATGTAAGCGCTAACATCA
bglu_2g08900 Bphy_4591 -125 6.7 CCATGTAAGCGCTAACATTT
Burkholderia phymatum STM815
Bphy_4590 Bphy_4590 -218 6.2 CCGTGTTAGCGCTTACATTT
Bphy_4591 Bphy_4591 -134 6.4 AGATGTAAGCGCTAACATTA
Burkholderia sp. 383
Bcep18194_C7623 Bphy_4591 -24 6.8 AAATGTAAGCGATTACATTC
Bcep18194_C7624 Bphy_4590 -237 6.8 GAATGTAATCGCTTACATTT
Burkholderia vietnamiensis G4
Bcep1808_1422 Bphy_4590 -240 6.9 CAATGTAATCGCTTACATTT
Bcep1808_1423 Bphy_4591 -21 6.7 AAATGTAAGCGATTACATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD