Regulon of Bphy_4590 in Burkholderia glumae BGR1

Properties
Regulator type:	Transcription factor
TF locus tag:	bglu_2g08870
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	Bphy_4590 - Burkholderia
Statistics of regulated genes:
- Genes	4
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Burkholderia
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -125 Score: 6.7 Sequence: CCATGTAAGCGCTAACATTT Position: -49 Score: 6.1 Sequence: AAATGTAAGCGCTAACATCA Locus tag: bglu_2g08900 Name: Bphy_4591 Funciton: Predicted sugar kinase Locus tag: bglu_2g08890 Name: Bphy_4592 Funciton: Predicted sugar transporter Locus tag: bglu_2g08880 Name: COG0329 Funciton: predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein Locus tag: bglu_2g08870 Name: Bphy_4590 Funciton: Predicted transcriptional regulator, LacI family
	bglu_2g08900	Bphy_4591	Predicted sugar kinase
	bglu_2g08890	Bphy_4592	Predicted sugar transporter
	bglu_2g08880	COG0329	predited dihydrodipicolinate synthase/N-acetylneuraminate lyase family protein
	bglu_2g08870	Bphy_4590	Predicted transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD