Regulon of GalR in Pasteurella multocida subsp. multocida str. Pm70

Properties
Regulator type:	Transcription factor
TF locus tag:	PM1037
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Pasteurellales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Pasteurellales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -209 Score: 5.6 Sequence: AACTGAAAACGGTTACATTT Locus tag: PM1037 Name: galR Funciton: Transcriptional regulator for galactose utilization, LacI family
	PM1037	galR	Transcriptional regulator for galactose utilization, LacI family
Position: -34 Score: 6 Sequence: AAATGTAACCGTTTTCAGTT Locus tag: PM1036 Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) Locus tag: PM1035 Name: galK Funciton: Galactokinase (EC 2.7.1.6) Locus tag: PM1034 Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3)
	PM1036	galT	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
	PM1035	galK	Galactokinase (EC 2.7.1.6)
	PM1034	galM	Aldose 1-epimerase (EC 5.1.3.3)
Position: -142 Score: 6.1 Sequence: AATTGTAATCGTTTTCACAA Locus tag: PM1038 Name: mglB Funciton: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) Locus tag: PM1039 Name: mglA Funciton: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) Locus tag: PM1040 Name: mglC Funciton: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)
	PM1038	mglB	Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
	PM1039	mglA	Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
	PM1040	mglC	Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD