Regulog GalR - Pasteurellales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Galactose utilization |
| Effector: | Galactose |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pasteurellales
- By TF family - LacI
- By effector - Galactose
- By pathway - Galactose utilization
| Genome | Genes | Operons |
|---|---|---|
| Actinobacillus pleuropneumoniae serovar 7 str. AP76 | ||
| Actinobacillus succinogenes 130Z | ||
| Aggregatibacter aphrophilus NJ8700 | 7 | 3 |
| Haemophilus ducreyi 35000HP | ||
| Haemophilus influenzae Rd KW20 | 7 | 3 |
| Haemophilus parasuis SH0165 | ||
| Haemophilus somnus 2336 | 6 | 2 |
| Mannheimia succiniciproducens MBEL55E | 8 | 3 |
| Pasteurella multocida subsp. multocida str. Pm70 | 7 | 3 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| galR |
|
|
*
Aggregatibacter aphrophilus NJ8700 Site: position = -224 score = 5.68734 sequence = TTATGAAAACGATTACAAAA Site: position = -76 score = 5.21674 sequence = AAAAGTAAGCGTTTTCAAAT Gene: NT05HA_1260: Transcriptional regulator for galactose utilization, LacI family |
|
*
Haemophilus influenzae Rd KW20 Site: position = -188 score = 5.86159 sequence = CAATGTAAACGATTACATTA Gene: HI0821: Transcriptional regulator for galactose utilization, LacI family |
|
|
*
Mannheimia succiniciproducens MBEL55E Site: position = -222 score = 5.77979 sequence = TATTGAAAACGGTTACATTT Site: position = -91 score = 5.65188 sequence = AAAAGTAACCGTTTTCAATA Gene: MS0644: Transcriptional regulator for galactose utilization, LacI family |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -209 score = 5.59158 sequence = AACTGAAAACGGTTACATTT Gene: PM1037: Transcriptional regulator for galactose utilization, LacI family |
Transcriptional regulator for galactose utilization, LacI family |
| CRON 2. | ||||||||||
| galT |
|
|
*
Aggregatibacter aphrophilus NJ8700 Site: position = -49 score = 6.30098 sequence = TTTTGTAATCGTTTTCATAA Gene: NT05HA_1259: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
|
*
Haemophilus influenzae Rd KW20 Site: position = -39 score = 6.21628 sequence = TAATGTAATCGTTTACATTG Gene: HI0820: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
|
*
Haemophilus somnus 2336 Site: position = -52 score = 6.27354 sequence = ATTTGTAATCGTTTACATTT Gene: HSM_0108: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
*2
Mannheimia succiniciproducens MBEL55E Site: position = -100 score = 6.23377 sequence = AAATGTAACCGTTTTCAATA Gene: MS0646: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) Gene: MS0647: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -34 score = 6.04218 sequence = AAATGTAACCGTTTTCAGTT Gene: PM1036: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10) |
| galK |
|
|
Gene: NT05HA_1258: Galactokinase (EC 2.7.1.6) |
|
Gene: HI0819: Galactokinase (EC 2.7.1.6) |
|
Gene: HSM_0109: Galactokinase (EC 2.7.1.6) |
Gene: MS0648: Galactokinase (EC 2.7.1.6) |
Gene: PM1035: Galactokinase (EC 2.7.1.6) |
Galactokinase (EC 2.7.1.6) |
| galM |
|
|
Gene: NT05HA_1257: Aldose 1-epimerase (EC 5.1.3.3) |
|
Gene: HI0818: Aldose 1-epimerase (EC 5.1.3.3) |
|
Gene: HSM_0110: Aldose 1-epimerase (EC 5.1.3.3) |
Gene: MS0649: Aldose 1-epimerase (EC 5.1.3.3) |
Gene: PM1034: Aldose 1-epimerase (EC 5.1.3.3) |
Aldose 1-epimerase (EC 5.1.3.3) |
| CRON 3. | ||||||||||
| mglB |
Gene: APP7_1513: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
Gene: Asuc_1898: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
*
Aggregatibacter aphrophilus NJ8700 Site: position = -187 score = 6.19678 sequence = AGATGTAATCGTTTTCATAA Gene: NT05HA_1261: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
|
*
Haemophilus influenzae Rd KW20 Site: position = -113 score = 6.07554 sequence = TTATGTAATCATTTTCATTT Gene: HI0822: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
Gene: HAPS_0442: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
*
Haemophilus somnus 2336 Site: position = -148 score = 6.28501 sequence = TTATGAAATCGTTTTCATAA Gene: HSM_0105: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
*
Mannheimia succiniciproducens MBEL55E Site: position = -161 score = 5.87085 sequence = TTATGTAATCGTTTCCACAT Gene: MS0643: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
*
Pasteurella multocida subsp. multocida str. Pm70 Site: position = -142 score = 6.11589 sequence = AATTGTAATCGTTTTCACAA Gene: PM1038: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) |
| mglA |
Gene: APP7_1514: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
Gene: Asuc_1897: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
Gene: NT05HA_1262: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
|
Gene: HI0823: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
Gene: HAPS_0443: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
Gene: HSM_0104: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
Gene: MS0642: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
Gene: PM1039: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) |
| mglC |
Gene: APP7_1515: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
Gene: Asuc_1896: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
Gene: NT05HA_1263: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
|
Gene: HI0824: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
Gene: HAPS_0444: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
Gene: HSM_0103: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
Gene: MS0641: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
Gene: PM1040: Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
Galactose/methyl galactoside ABC transporter, permease protein mglC (TC 3.A.1.2.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |