Regulon of GalR in Vibrio vulnificus CMCP6

Properties
Regulator type:	Transcription factor
TF locus tag:	VV1_1775, VV21323
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Vibrionales
Statistics of regulated genes:
- Genes	11
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 5.6 Sequence: AAAAGATAACGTTTACACTA Locus tag: VV1_1775 Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family
	VV1_1775	galR	Transcriptional regulator for galactose and lactose utilization, LacI family
Position: -96 Score: 5.2 Sequence: TCATGAAAACGTTTCCATAG Locus tag: VV21329 Name: lacP Funciton: predicted lactoporin Locus tag: VV21328 Name: VV21328 Funciton: lactose operon periplasmic protein Locus tag: VV2_1327 Name: lacZ Funciton: Beta-galactosidase (EC 3.2.1.23)
	VV21329	lacP	predicted lactoporin
	VV21328	VV21328	lactose operon periplasmic protein
	VV2_1327	lacZ	Beta-galactosidase (EC 3.2.1.23)
Position: -90 Score: 5.3 Sequence: AAGGGTAAACGTTTTCACCA Locus tag: VV21326 Name: mglB Funciton: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) Locus tag: VV21325 Name: mglA Funciton: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) Locus tag: VV21324 Name: mglC Funciton: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
	VV21326	mglB	Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
	VV21325	mglA	Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
	VV21324	mglC	Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
Position: -148 Score: 5.2 Sequence: GTCTGTAAACGTTTCCATAA Locus tag: VV21332 Name: galW Funciton: Predicted Na+/alpha-galactoside symporter
	VV21332	galW	Predicted Na+/alpha-galactoside symporter
Position: -119 Score: 4.8 Sequence: AAATGCAATCGATTACACAT Locus tag: VV21682 Name: VV21682 Funciton: Chitinase, putative
	VV21682	VV21682	Chitinase, putative
Position: -125 Score: 6.4 Sequence: TAGTGAAAACGTTTACACTT Locus tag: VV1_1770 Name: galE Funciton: UDP-glucose 4-epimerase (EC 5.1.3.2) Locus tag: VV1_1771 Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
	VV1_1770	galE	UDP-glucose 4-epimerase (EC 5.1.3.2)
	VV1_1771	galT	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD