Regulon of GalR in Vibrio shilonii AK1

Properties
Regulator type:	Transcription factor
TF locus tag:	VSAK1_10693, VSAK1_00922
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Vibrionales
Statistics of regulated genes:
- Genes	14
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -245 Score: 5.6 Sequence: TCATGGAAACGTTTACAATT Position: -115 Score: 5.2 Sequence: TTTTGGAAACGATTACTCTA Locus tag: VSAK1_00922 Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family
	VSAK1_00922	galR	Transcriptional regulator for galactose and lactose utilization, LacI family
Position: -223 Score: 4.7 Sequence: AATTGTTAACGTATCCAAAT Position: -58 Score: 5.6 Sequence: CTGTGTAAACGTTTCCAAAT Locus tag: VSAK1_10773 Name: lacE Funciton: Probable lactose uptake ABC transporter, periplasmic solute-binding protein Locus tag: VSAK1_10768 Name: lacF Funciton: Probable lactose uptake ABC transporter, permease protein 1 Locus tag: VSAK1_10763 Name: lacG Funciton: Probable lactose uptake ABC transporter, permease protein 2 Locus tag: VSAK1_10758 Name: lacZ Funciton: Beta-galactosidase (EC 3.2.1.23) Locus tag: VSAK1_10753 Name: lacK Funciton: Probable lactose uptake ABC transporter, ATP-binding protein
	VSAK1_10773	lacE	Probable lactose uptake ABC transporter, periplasmic solute-binding protein
	VSAK1_10768	lacF	Probable lactose uptake ABC transporter, permease protein 1
	VSAK1_10763	lacG	Probable lactose uptake ABC transporter, permease protein 2
	VSAK1_10758	lacZ	Beta-galactosidase (EC 3.2.1.23)
	VSAK1_10753	lacK	Probable lactose uptake ABC transporter, ATP-binding protein
Position: -327 Score: 5.5 Sequence: TATTGTAAACGTTCTCATAA Position: -97 Score: 4.7 Sequence: TGGGTTAAACGTTTTCACTT Locus tag: VSAK1_10743 Name: mglB Funciton: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) Locus tag: VSAK1_10738 Name: mglA Funciton: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) Locus tag: VSAK1_10733 Name: mglC Funciton: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
	VSAK1_10743	mglB	Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
	VSAK1_10738	mglA	Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
	VSAK1_10733	mglC	Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
Position: -238 Score: 4.7 Sequence: TTGTGTAATCGTTTAACTTT Position: -140 Score: 6.6 Sequence: TAGTGTAAACGTTTACACTT Locus tag: VSAK1_10728 Name: galE Funciton: UDP-glucose 4-epimerase (EC 5.1.3.2) Locus tag: VSAK1_10723 Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) Locus tag: VSAK1_10718 Name: galK Funciton: Galactokinase (EC 2.7.1.6) Locus tag: VSAK1_10713 Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3)
	VSAK1_10728	galE	UDP-glucose 4-epimerase (EC 5.1.3.2)
	VSAK1_10723	galT	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
	VSAK1_10718	galK	Galactokinase (EC 2.7.1.6)
	VSAK1_10713	galM	Aldose 1-epimerase (EC 5.1.3.3)
Position: -103 Score: 5.6 Sequence: CAGTGTAAACGTTTCCAGTT Locus tag: VSAK1_00937 Name: galW Funciton: Predicted Na+/alpha-galactoside symporter
	VSAK1_00937	galW	Predicted Na+/alpha-galactoside symporter

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD