Regulon of GalR in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type:	Transcription factor
TF locus tag:	VIBHAR_03325
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Vibrionales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -149 Score: 4.7 Sequence: CTAAGATAACGTTTATACAT Locus tag: VIBHAR_03325 Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family
	VIBHAR_03325	galR	Transcriptional regulator for galactose and lactose utilization, LacI family
Position: -254 Score: 6 Sequence: TTGTGTAAACGTTTATACAT Position: -153 Score: 5.4 Sequence: TTGTGGAAACGTTTGCTCTA Locus tag: VIBHAR_03331 Name: galE Funciton: UDP-glucose 4-epimerase (EC 5.1.3.2)
	VIBHAR_03331	galE	UDP-glucose 4-epimerase (EC 5.1.3.2)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD