Regulon of GalR in Vibrio cholerae O1 biovar eltor str. N16961

Properties
Regulator type:	Transcription factor
TF locus tag:	VC2337
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Vibrionales
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -139 Score: 5.5 Sequence: CATTAAAAACGTTTACACTT Locus tag: VC2337 Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family
	VC2337	galR	Transcriptional regulator for galactose and lactose utilization, LacI family
Position: -107 Score: 5.4 Sequence: CTGAGTAAACGTTTTCACTG Locus tag: VC1325 Name: mglB Funciton: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
	VC1325	mglB	Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
Position: -162 Score: 5.6 Sequence: TTGTGAAAGCGTTTACACTG Locus tag: VC1596 Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) Locus tag: VC1595 Name: galK Funciton: Galactokinase (EC 2.7.1.6) Locus tag: VC1594 Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3)
	VC1596	galT	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
	VC1595	galK	Galactokinase (EC 2.7.1.6)
	VC1594	galM	Aldose 1-epimerase (EC 5.1.3.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD