Regulon of GalR in Photobacterium profundum SS9

Properties
Regulator type:	Transcription factor
TF locus tag:	PBPRA2078
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Galactose utilization
Effector:	Galactose
Regulog:	GalR - Vibrionales
Statistics of regulated genes:
- Genes	8
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 30 sites [see more]

Member of regulog collections

By taxonomy - Vibrionales
By TF family - LacI
By effector - Galactose
By pathway - Galactose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -152 Score: 5 Sequence: TACTGATAACGATTACAAAA Locus tag: PBPRA2078 Name: galR Funciton: Transcriptional regulator for galactose and lactose utilization, LacI family
	PBPRA2078	galR	Transcriptional regulator for galactose and lactose utilization, LacI family
Position: -154 Score: 5 Sequence: TTGGGGGAACGTTTACATTA Locus tag: PBPRB1872 Name: mglB Funciton: Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3) Locus tag: PBPRB1871 Name: mglA Funciton: Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17) Locus tag: PBPRB1870 Name: mglC Funciton: Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
	PBPRB1872	mglB	Galactose/methyl galactoside ABC transport system, D-galactose-binding periplasmic protein MglB (TC 3.A.1.2.3)
	PBPRB1871	mglA	Galactose/methyl galactoside ABC transport system, ATP-binding protein MglA (EC 3.6.3.17)
	PBPRB1870	mglC	Galactose/methyl galactoside ABC transport system, permease protein MglC (TC 3.A.1.2.3)
Position: -105 Score: 6 Sequence: TCGTGGAAACGTTTACACAA Locus tag: PBPRA2082 Name: galE Funciton: UDP-glucose 4-epimerase (EC 5.1.3.2) Locus tag: PBPRA2081 Name: galT Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12) Locus tag: PBPRA2080 Name: galK Funciton: Galactokinase (EC 2.7.1.6) Locus tag: PBPRA2079 Name: galM Funciton: Aldose 1-epimerase (EC 5.1.3.3)
	PBPRA2082	galE	UDP-glucose 4-epimerase (EC 5.1.3.2)
	PBPRA2081	galT	Galactose-1-phosphate uridylyltransferase (EC 2.7.7.12)
	PBPRA2080	galK	Galactokinase (EC 2.7.1.6)
	PBPRA2079	galM	Aldose 1-epimerase (EC 5.1.3.3)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD