Regulon of PSPTO0485 in Pseudomonas syringae pv. tomato str. DC3000

Properties
Regulator type:	Transcription factor
TF locus tag:	PSPTO0485
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Regulog:	PSPTO0485 - Pseudomonadaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -29 Score: 4.8 Sequence: CAATGAGATCGATCTCAAAG Locus tag: PSPTO0485 Name: PSPTO0485 Funciton: Predicted sugar utilization transcriptional regulator, LacI family Locus tag: PSPTO0486 Name: RSc1791 Funciton: Predicted sugar ABC transporter, substrate-binding protein Locus tag: PSPTO0487 Name: RSc1792 Funciton: Predicted sugar ABC transporter, permease protein 1 Locus tag: PSPTO0488 Name: RSc1793 Funciton: ABC transporter, permease protein Locus tag: PSPTO0489 Name: RSc1794 Funciton: ABC transporter, ATP-binding protein Locus tag: PSPTO0490 Name: RSc1795 Funciton: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)
	PSPTO0485	PSPTO0485	Predicted sugar utilization transcriptional regulator, LacI family
	PSPTO0486	RSc1791	Predicted sugar ABC transporter, substrate-binding protein
	PSPTO0487	RSc1792	Predicted sugar ABC transporter, permease protein 1
	PSPTO0488	RSc1793	ABC transporter, permease protein
	PSPTO0489	RSc1794	ABC transporter, ATP-binding protein
	PSPTO0490	RSc1795	3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD