Profile of regulator PSPTO0485 in Pseudomonadaceae
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | PSPTO0485 - Pseudomonadaceae |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Pseudomonas syringae pv. tomato str. DC3000 | |||||
| PSPTO0485 | PSPTO0485 | -29 | 4.8 | CAATGAGATCGATCTCAAAG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |