Regulog PSPTO0485 - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Pseudomonadaceae
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Azotobacter vinelandii AvOP | ||
| Pseudomonas aeruginosa PAO1 | ||
| Pseudomonas entomophila L48 | ||
| Pseudomonas fluorescens Pf-5 | ||
| Pseudomonas mendocina ymp | ||
| Pseudomonas putida KT2440 | ||
| Pseudomonas stutzeri A1501 | ||
| Pseudomonas syringae pv. tomato str. DC3000 | 6 | 1 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| PSPTO0485 |
|
|
|
|
|
|
|
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -29 score = 4.80416 sequence = CAATGAGATCGATCTCAAAG Gene: PSPTO0485: Predicted sugar utilization transcriptional regulator, LacI family |
Predicted sugar utilization transcriptional regulator, LacI family |
| RSc1791 |
|
|
|
|
|
|
|
Gene: PSPTO0486: Predicted sugar ABC transporter, substrate-binding protein |
Predicted sugar ABC transporter, substrate-binding protein |
| RSc1792 |
|
|
|
|
|
|
|
Gene: PSPTO0487: Predicted sugar ABC transporter, permease protein 1 |
Predicted sugar ABC transporter, permease protein 1 |
| RSc1793 |
|
|
|
|
|
|
|
Gene: PSPTO0488: ABC transporter, permease protein |
Predicted sugar ABC transporter, permease protein 2 |
| RSc1794 |
|
|
|
|
|
|
|
Gene: PSPTO0489: ABC transporter, ATP-binding protein |
Predicted sugar ABC transporter, ATP-binding protein |
| RSc1795 |
|
|
|
|
|
|
|
Gene: PSPTO0490: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17) |
3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |