Regulog PSPTO0485 - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Pseudomonadaceae
By TF family - LacI
By pathway - Sugar utilization

Statistics of regulated genes
Genome	Genes	Operons
Azotobacter vinelandii AvOP
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas fluorescens Pf-5
Pseudomonas mendocina ymp
Pseudomonas putida KT2440
Pseudomonas stutzeri A1501
Pseudomonas syringae pv. tomato str. DC3000	6	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes									Function

CRON 1.
PSPTO0485	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -29 score = 4.80416 sequence = CAATGAGATCGATCTCAAAG Gene: PSPTO0485: Predicted sugar utilization transcriptional regulator, LacI family	Predicted sugar utilization transcriptional regulator, LacI family
RSc1791	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0486: Predicted sugar ABC transporter, substrate-binding protein	Predicted sugar ABC transporter, substrate-binding protein
RSc1792	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0487: Predicted sugar ABC transporter, permease protein 1	Predicted sugar ABC transporter, permease protein 1
RSc1793	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0488: ABC transporter, permease protein	Predicted sugar ABC transporter, permease protein 2
RSc1794	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0489: ABC transporter, ATP-binding protein	Predicted sugar ABC transporter, ATP-binding protein
RSc1795	Azotobacter vinelandii AvOP	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO0490: 3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)	3',5'-cyclic-nucleotide phosphodiesterase (EC 3.1.4.17)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PSPTO0485 - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --