Regulon of OG2516_10476 in Oceanicola granulosus HTCC2516

Properties
Regulator type:	Transcription factor
TF locus tag:	OG2516_10476
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	OG2516_10476 - Rhodobacterales
Statistics of regulated genes:
- Genes	8
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -80 Score: 5.9 Sequence: TCCTGTAAACGTTTACGACG Position: -28 Score: 5.5 Sequence: TTTTGAAAACGTTTACGAAA Locus tag: OG2516_10476 Name: OG2516_10476 Funciton: Transcriptional regulator for sugar utilization, LacI family
	OG2516_10476	OG2516_10476	Transcriptional regulator for sugar utilization, LacI family
Position: -111 Score: 5.5 Sequence: TTTCGTAAACGTTTTCAAAA Position: -59 Score: 5.9 Sequence: CGTCGTAAACGTTTACAGGA Locus tag: OG2516_10471 Name: COG0673 Funciton: Predicted dehydrogenases and related proteins Locus tag: OG2516_10466 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases Locus tag: OG2516_10461 Name: SMb21595 Funciton: Sugar ABC transporter, periplasmic sugar-binding protein Locus tag: OG2516_10456 Name: SMb21594 Funciton: Sugar ABC transporter, membrane spanning protein Locus tag: OG2516_10451 Name: SMb21593 Funciton: Sugar ABC transporter, inner membrane protein Locus tag: OG2516_10446 Name: SMb21592 Funciton: Sugar ABC transporter, ATP-binding protein Locus tag: OG2516_10441 Name: COG3533 Funciton: Uncharacterized protein conserved in bacteria
	OG2516_10471	COG0673	Predicted dehydrogenases and related proteins
	OG2516_10466	COG1082	Sugar phosphate isomerases/epimerases
	OG2516_10461	SMb21595	Sugar ABC transporter, periplasmic sugar-binding protein
	OG2516_10456	SMb21594	Sugar ABC transporter, membrane spanning protein
	OG2516_10451	SMb21593	Sugar ABC transporter, inner membrane protein
	OG2516_10446	SMb21592	Sugar ABC transporter, ATP-binding protein
	OG2516_10441	COG3533	Uncharacterized protein conserved in bacteria

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD