Profile of regulator OG2516_10476 in Rhodobacterales
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sugar utilization |
| Effector: | |
| Regulog: | OG2516_10476 - Rhodobacterales |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By pathway - Sugar utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Oceanicola granulosus HTCC2516 | |||||
| OG2516_10471 | COG0673 | -111 | 5.5 | TTTCGTAAACGTTTTCAAAA | |
| OG2516_10471 | COG0673 | -59 | 5.9 | CGTCGTAAACGTTTACAGGA | |
| OG2516_10476 | OG2516_10476 | -80 | 5.9 | TCCTGTAAACGTTTACGACG | |
| OG2516_10476 | OG2516_10476 | -28 | 5.5 | TTTTGAAAACGTTTACGAAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |