Regulog OG2516_10476 - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sugar utilization |
| Effector: | |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By pathway - Sugar utilization
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | ||
| Loktanella vestfoldensis SKA53 | ||
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | ||
| Oceanicola granulosus HTCC2516 | 8 | 2 |
| Paracoccus denitrificans PD1222 | ||
| Rhodobacter sphaeroides 2.4.1 | ||
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| COG0673 |
|
|
|
|
|
*
Oceanicola granulosus HTCC2516 Site: position = -111 score = 5.52629 sequence = TTTCGTAAACGTTTTCAAAA Site: position = -59 score = 5.89093 sequence = CGTCGTAAACGTTTACAGGA Gene: OG2516_10471: Predicted dehydrogenases and related proteins |
|
|
|
|
|
|
|
|
|
Predicted dehydrogenases and related proteins |
| COG1082 |
|
|
|
|
|
Gene: OG2516_10466: Sugar phosphate isomerases/epimerases |
|
|
|
|
|
|
|
|
|
Sugar phosphate isomerases/epimerases |
| SMb21595 |
|
|
|
|
|
Gene: OG2516_10461: Sugar ABC transporter, periplasmic sugar-binding protein |
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, periplasmic sugar-binding protein |
| SMb21594 |
|
|
|
|
|
Gene: OG2516_10456: Sugar ABC transporter, membrane spanning protein |
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, membrane spanning protein |
| SMb21593 |
|
|
|
|
|
Gene: OG2516_10451: Sugar ABC transporter, inner membrane protein |
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, inner membrane protein |
| SMb21592 |
|
|
|
|
|
Gene: OG2516_10446: Sugar ABC transporter, ATP-binding protein |
|
|
|
|
|
|
|
|
|
Sugar ABC transporter, ATP-binding protein |
| COG3533 |
|
|
|
|
|
Gene: OG2516_10441: Uncharacterized protein conserved in bacteria |
|
|
|
|
|
|
|
|
|
Uncharacterized protein conserved in bacteria |
| CRON 2. | ||||||||||||||||
| OG2516_10476 |
|
|
|
|
|
*
Oceanicola granulosus HTCC2516 Site: position = -80 score = 5.89093 sequence = TCCTGTAAACGTTTACGACG Site: position = -28 score = 5.52629 sequence = TTTTGAAAACGTTTACGAAA Gene: OG2516_10476: Transcriptional regulator for sugar utilization, LacI family |
|
|
|
|
|
|
|
|
|
Transcriptional regulator for sugar utilization, LacI family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |