Regulon of CadR-PbrR in Phenylobacterium zucineum HLK1

Properties
Regulator type:	Transcription factor
TF locus tag:	PHZ_p0235, PHZ_c1428
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Caulobacterales
Statistics of regulated genes:
- Genes	11
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Caulobacterales
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -19 Score: 5.7 Sequence: ATCCTCTACCTACTAGAGGAT Locus tag: PHZ_p0236 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: PHZ_p0237 Name: null Funciton: Heavy metal RND efflux outer membrane protein, CzcC family Locus tag: PHZ_p0238 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: PHZ_p0239 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: PHZ_p0240 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
	PHZ_p0236	czcD	Co/Zn/Cd efflux protein
	PHZ_p0237		Heavy metal RND efflux outer membrane protein, CzcC family
	PHZ_p0238	czcC	Heavy metal efflux RND outer membrane protein
	PHZ_p0239	czcB	Heavy metal efflux RND transporter, membrane fusion protein
	PHZ_p0240	czcA	Heavy metal efflux RND transmembrane protein
Position: -103 Score: 6.5 Sequence: ATCCTCTAGCGACTAGAGGAT Locus tag: PHZ_c1429 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: PHZ_c1430 Name: null Funciton: hypothetical protein Locus tag: PHZ_c1431 Name: czcC Funciton: Heavy metal efflux RND outer membrane protein Locus tag: PHZ_c1432 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: PHZ_c1433 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein Locus tag: PHZ_c1434 Name: czcD2 Funciton: Co/Zn/Cd efflux protein
	PHZ_c1429	czcD	Co/Zn/Cd efflux protein
	PHZ_c1430		hypothetical protein
	PHZ_c1431	czcC	Heavy metal efflux RND outer membrane protein
	PHZ_c1432	czcB	Heavy metal efflux RND transporter, membrane fusion protein
	PHZ_c1433	czcA	Heavy metal efflux RND transmembrane protein
	PHZ_c1434	czcD2	Co/Zn/Cd efflux protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD