Regulog CadR-PbrR - Caulobacterales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Caulobacterales
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Caulobacter crescentus CB15 | ||
| Caulobacter segnis ATCC 21756 | ||
| Caulobacter sp. K31 | 2 | 1 |
| Phenylobacterium zucineum HLK1 | 11 | 2 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| czcD |
|
|
*
Caulobacter sp. K31 Site: position = -34 score = 6.47825 sequence = ATCCTCTAGTGGCTAGAGGAT Gene: Caul_2301: Co/Zn/Cd efflux protein |
*2
Phenylobacterium zucineum HLK1 Site: position = -103 score = 6.47825 sequence = ATCCTCTAGCGACTAGAGGAT Gene: PHZ_c1429: Co/Zn/Cd efflux protein Site: position = -19 score = 5.6668 sequence = ATCCTCTACCTACTAGAGGAT Gene: PHZ_p0236: Co/Zn/Cd efflux protein |
Co/Zn/Cd efflux protein |
| CC2720 |
Gene: CC2720: hypothetical protein |
|
Gene: Caul_2293: hypothetical protein |
Gene: PHZ_c1430: hypothetical protein |
hypothetical protein |
| czcC |
Gene: CC2721: Heavy metal efflux RND outer membrane protein |
2
Caulobacter segnis ATCC 21756 Gene: Cseg_2387: Heavy metal efflux RND outer membrane protein Gene: Cseg_2511: Heavy metal efflux RND outer membrane protein |
2
Caulobacter sp. K31 Gene: Caul_2294: Heavy metal efflux RND outer membrane protein Gene: Caul_2284: Heavy metal efflux RND outer membrane protein |
3
Phenylobacterium zucineum HLK1 Gene: PHZ_p0238: Heavy metal efflux RND outer membrane protein Gene: PHZ_c1431: Heavy metal efflux RND outer membrane protein Gene: PHZ_p0254: Heavy metal efflux RND outer membrane protein |
Heavy metal efflux RND outer membrane protein |
| czcB |
Gene: CC2722: Heavy metal efflux RND transporter, membrane fusion protein |
2
Caulobacter segnis ATCC 21756 Gene: Cseg_2388: Heavy metal efflux RND transporter, membrane fusion protein Gene: Cseg_2512: Heavy metal efflux RND transporter, membrane fusion protein |
2
Caulobacter sp. K31 Gene: Caul_2295: Heavy metal efflux RND transporter, membrane fusion protein Gene: Caul_2285: Heavy metal efflux RND transporter, membrane fusion protein |
3
Phenylobacterium zucineum HLK1 Gene: PHZ_c1432: Heavy metal efflux RND transporter, membrane fusion protein Gene: PHZ_p0239: Heavy metal efflux RND transporter, membrane fusion protein Gene: PHZ_p0255: Heavy metal efflux RND transporter, membrane fusion protein |
Heavy metal efflux RND transporter, membrane fusion protein |
| czcA |
Gene: CC2724: Heavy metal efflux RND transmembrane protein |
2
Caulobacter segnis ATCC 21756 Gene: Cseg_2389: Heavy metal efflux RND transmembrane protein Gene: Cseg_2513: Heavy metal efflux RND transmembrane protein |
2
Caulobacter sp. K31 Gene: Caul_2297: Heavy metal efflux RND transmembrane protein Gene: Caul_2286: Heavy metal efflux RND transmembrane protein |
3
Phenylobacterium zucineum HLK1 Gene: PHZ_c1433: Heavy metal efflux RND transmembrane protein Gene: PHZ_p0240: Heavy metal efflux RND transmembrane protein Gene: PHZ_p0256: Heavy metal efflux RND transmembrane protein |
Heavy metal efflux RND transmembrane protein |
| czcD2 |
|
|
|
2
Phenylobacterium zucineum HLK1 Gene: PHZ_c1434: Co/Zn/Cd efflux protein Gene: PHZ_p0262: Co/Zn/Cd efflux protein |
Co/Zn/Cd efflux protein |
| Caul_2283 |
|
|
Gene: Caul_2283: hypothetical protein |
Gene: PHZ_p0237: Heavy metal RND efflux outer membrane protein, CzcC family |
hypothetical protein |
| pbrT |
|
|
Gene: Caul_2302: Pb(II) uptake protein, ILT family |
|
Pb(II) uptake protein, ILT family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |