Regulon of MerR in Sphingopyxis alaskensis RB2256

Properties
Regulator type:	Transcription factor
TF locus tag:	Sala_2435, Sala_1623
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Sphingomonadales
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Sphingomonadales
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -35 Score: 6 Sequence: ACTCCGTACCATGGTACGGATG Locus tag: Sala_1624 Name: grxC Funciton: Glutaredoxin
	Sala_1624	grxC	Glutaredoxin
Position: -10 Score: 6.5 Sequence: ACTCCGTACTATGGTACGGAGC Locus tag: Sala_2436 Name: grxC Funciton: Glutaredoxin
	Sala_2436	grxC	Glutaredoxin

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD