Regulog MerR - Sphingomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/Alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Erythrobacter litoralis HTCC2594
Erythrobacter sp. NAP1
Novosphingobium aromaticivorans DSM 12444	1	1
Sphingopyxis alaskensis RB2256	2	2
Sphingobium japonicum UT26S
Sphingomonas wittichii RW1	1	1
Zymomonas mobilis subsp. mobilis ZM4

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes								Function

CRON 1.
grxC	Erythrobacter litoralis HTCC2594	Erythrobacter sp. NAP1	* Novosphingobium aromaticivorans DSM 12444 Site: position = -36 score = 5.99593 sequence = ACTCCGTACCATGGTACGCAAG Gene: Saro_2123: Glutaredoxin	2 Sphingopyxis alaskensis RB2256* Site: position = -10 score = 6.48361 sequence = ACTCCGTACTATGGTACGGAGC Gene: Sala_2436: Glutaredoxin Site: position = -35 score = 6.01787 sequence = ACTCCGTACCATGGTACGGATG Gene: Sala_1624: Glutaredoxin	Sphingobium japonicum UT26S	* Sphingomonas wittichii RW1 Site: position = -65 score = 4.06175 sequence = CAACCGTACCATGGTACAGCCC Gene: Swit_1124: Glutaredoxin	Zymomonas mobilis subsp. mobilis ZM4	Glutaredoxin

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --