Regulon of MerR in Methylibium petroleiphilum PM1

Properties
Regulator type:	Transcription factor
TF locus tag:	Mpe_A1661
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Comamonadaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 5.6 Sequence: ACTCCGTACTCAGGTACGTACC Locus tag: Mpe_A1662 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Mpe_A1663 Name: merP Funciton: Periplasmic mercury (+2) binding protein
	Mpe_A1662	merT	Mercury uptake inner membane protein
	Mpe_A1663	merP	Periplasmic mercury (+2) binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD