Regulog MerR - Comamonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/Beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Comamonadaceae
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Statistics of regulated genes
Genome	Genes	Operons
Acidovorax avenae subsp. citrulli AAC00-1
Acidovorax sp. JS42	5	2
Comamonas testosteroni KF-1	6	1
Delftia acidovorans SPH-1	3	1
Polaromonas naphthalenivorans CJ2
Polaromonas sp. JS666	8	2
Rhodoferax ferrireducens DSM 15236
Variovorax paradoxus S110
Verminephrobacter eiseniae EF01-2
Methylibium petroleiphilum PM1	2	1
Leptothrix cholodnii SP-6

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes												Function

CRON 1.
merT	Acidovorax avenae subsp. citrulli AAC00-1	2 Acidovorax sp. JS42* Site: position = -34 score = 6.54199 sequence = ACTCCGTACTTAACTACGGAAG Gene: Ajs_1475: Mercury uptake inner membane protein Site: position = -63 score = 6.17332 sequence = ACTCCGTAGTTGACTACGGAAG Gene: Ajs_1300: Mercury uptake inner membane protein	* Comamonas testosteroni KF-1 Site: position = -63 score = 6.32981 sequence = ACTCCGTACATAACTACGGAAG Gene: CtesDRAFT_1787: Mercury uptake inner membane protein	* Delftia acidovorans SPH-1 Site: position = -63 score = 6.17332 sequence = ACTCCGTAGTTGACTACGGAAG Gene: Daci_0485: Mercury uptake inner membane protein	Polaromonas naphthalenivorans CJ2	2 Polaromonas sp. JS666* Site: position = -34 score = 6.72555 sequence = ACTCCGTACTTAAGTACGGAAG Gene: Bpro_4797: Mercury uptake inner membane protein Site: position = -63 score = 6.10436 sequence = ACTCCGTACATTACTACGGAAA Gene: Bpro_2231: Mercury uptake inner membane protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	* Methylibium petroleiphilum PM1 Site: position = -57 score = 5.64831 sequence = ACTCCGTACTCAGGTACGTACC Gene: Mpe_A1662: Mercury uptake inner membane protein	Leptothrix cholodnii SP-6	Mercury uptake inner membane protein
merP	Acidovorax avenae subsp. citrulli AAC00-1	2 Acidovorax sp. JS42 Gene: Ajs_1476: Periplasmic mercury (+2) binding protein Gene: Ajs_1299: Periplasmic mercury (+2) binding protein	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1786: Periplasmic mercury (+2) binding protein	Delftia acidovorans SPH-1 Gene: Daci_0484: Periplasmic mercury (+2) binding protein	Polaromonas naphthalenivorans CJ2	2 Polaromonas sp. JS666 Gene: Bpro_4796: Periplasmic mercury (+2) binding protein Gene: Bpro_2230: Periplasmic mercury (+2) binding protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1 Gene: Mpe_A1663: Periplasmic mercury (+2) binding protein	Leptothrix cholodnii SP-6	Periplasmic mercury (+2) binding protein
merC	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1785: Mercury uptake inner membane protein	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_2229: Mercury uptake inner membane protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Mercury uptake inner membane protein
merA	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42 Gene: Ajs_1298: Mercuric ion reductase (EC 1.16.1.1)	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1784: Mercuric ion reductase (EC 1.16.1.1)	Delftia acidovorans SPH-1 Gene: Daci_0483: Mercuric ion reductase (EC 1.16.1.1)	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_2228: Mercuric ion reductase (EC 1.16.1.1)	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Mercuric ion reductase (EC 1.16.1.1)
merD	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1783: Mercuric resistance operon coregulator	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_2227: Mercuric resistance operon coregulator	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Mercuric resistance operon coregulator
merE	Acidovorax avenae subsp. citrulli AAC00-1	Acidovorax sp. JS42	Comamonas testosteroni KF-1 Gene: CtesDRAFT_1782: Putative mercury resistance protein	Delftia acidovorans SPH-1	Polaromonas naphthalenivorans CJ2	Polaromonas sp. JS666 Gene: Bpro_2226: Putative mercury resistance protein	Rhodoferax ferrireducens DSM 15236	Variovorax paradoxus S110	Verminephrobacter eiseniae EF01-2	Methylibium petroleiphilum PM1	Leptothrix cholodnii SP-6	Putative mercury resistance protein

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog MerR - Comamonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --