Regulog MerR - Comamonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/Beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Comamonadaceae
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Acidovorax avenae subsp. citrulli AAC00-1 | ||
| Acidovorax sp. JS42 | 5 | 2 |
| Comamonas testosteroni KF-1 | 6 | 1 |
| Delftia acidovorans SPH-1 | 3 | 1 |
| Polaromonas naphthalenivorans CJ2 | ||
| Polaromonas sp. JS666 | 8 | 2 |
| Rhodoferax ferrireducens DSM 15236 | ||
| Variovorax paradoxus S110 | ||
| Verminephrobacter eiseniae EF01-2 | ||
| Methylibium petroleiphilum PM1 | 2 | 1 |
| Leptothrix cholodnii SP-6 |
| Genes | Function | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||
| merT |
|
*2
Acidovorax sp. JS42 Site: position = -34 score = 6.54199 sequence = ACTCCGTACTTAACTACGGAAG Gene: Ajs_1475: Mercury uptake inner membane protein Site: position = -63 score = 6.17332 sequence = ACTCCGTAGTTGACTACGGAAG Gene: Ajs_1300: Mercury uptake inner membane protein |
*
Comamonas testosteroni KF-1 Site: position = -63 score = 6.32981 sequence = ACTCCGTACATAACTACGGAAG Gene: CtesDRAFT_1787: Mercury uptake inner membane protein |
*
Delftia acidovorans SPH-1 Site: position = -63 score = 6.17332 sequence = ACTCCGTAGTTGACTACGGAAG Gene: Daci_0485: Mercury uptake inner membane protein |
|
*2
Polaromonas sp. JS666 Site: position = -34 score = 6.72555 sequence = ACTCCGTACTTAAGTACGGAAG Gene: Bpro_4797: Mercury uptake inner membane protein Site: position = -63 score = 6.10436 sequence = ACTCCGTACATTACTACGGAAA Gene: Bpro_2231: Mercury uptake inner membane protein |
|
|
|
*
Methylibium petroleiphilum PM1 Site: position = -57 score = 5.64831 sequence = ACTCCGTACTCAGGTACGTACC Gene: Mpe_A1662: Mercury uptake inner membane protein |
|
Mercury uptake inner membane protein |
| merP |
|
2
Acidovorax sp. JS42 Gene: Ajs_1476: Periplasmic mercury (+2) binding protein Gene: Ajs_1299: Periplasmic mercury (+2) binding protein |
Gene: CtesDRAFT_1786: Periplasmic mercury (+2) binding protein |
Gene: Daci_0484: Periplasmic mercury (+2) binding protein |
|
2
Polaromonas sp. JS666 Gene: Bpro_4796: Periplasmic mercury (+2) binding protein Gene: Bpro_2230: Periplasmic mercury (+2) binding protein |
|
|
|
Gene: Mpe_A1663: Periplasmic mercury (+2) binding protein |
|
Periplasmic mercury (+2) binding protein |
| merC |
|
|
Gene: CtesDRAFT_1785: Mercury uptake inner membane protein |
|
|
Gene: Bpro_2229: Mercury uptake inner membane protein |
|
|
|
|
|
Mercury uptake inner membane protein |
| merA |
|
Gene: Ajs_1298: Mercuric ion reductase (EC 1.16.1.1) |
Gene: CtesDRAFT_1784: Mercuric ion reductase (EC 1.16.1.1) |
Gene: Daci_0483: Mercuric ion reductase (EC 1.16.1.1) |
|
Gene: Bpro_2228: Mercuric ion reductase (EC 1.16.1.1) |
|
|
|
|
|
Mercuric ion reductase (EC 1.16.1.1) |
| merD |
|
|
Gene: CtesDRAFT_1783: Mercuric resistance operon coregulator |
|
|
Gene: Bpro_2227: Mercuric resistance operon coregulator |
|
|
|
|
|
Mercuric resistance operon coregulator |
| merE |
|
|
Gene: CtesDRAFT_1782: Putative mercury resistance protein |
|
|
Gene: Bpro_2226: Putative mercury resistance protein |
|
|
|
|
|
Putative mercury resistance protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |