Regulon of MerR in Stenotrophomonas maltophilia K279a

Properties
Regulator type:	Transcription factor
TF locus tag:	Smlt2409
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Xanthomonadales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -66 Score: 6.4 Sequence: ACTCCGTACTTGACTACGGAAG Locus tag: Smlt2410 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Smlt2411 Name: merP Funciton: Periplasmic mercury(+2) binding protein Locus tag: Smlt2412 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1)
	Smlt2410	merT	Mercury uptake inner membane protein
	Smlt2411	merP	Periplasmic mercury(+2) binding protein
	Smlt2412	merA	Mercuric ion reductase (EC 1.16.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD