Regulog MerR - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Xylella fastidiosa 9a5c
Xanthomonas axonopodis pv. citri str. 306
Xanthomonas campestris pv. campestris str. ATCC 33913
Stenotrophomonas maltophilia K279a	3	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
merT	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	* Stenotrophomonas maltophilia K279a Site: position = -66 score = 6.35688 sequence = ACTCCGTACTTGACTACGGAAG Gene: Smlt2410: Mercury uptake inner membane protein	Mercury uptake inner membane protein
merP	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2411: Periplasmic mercury(+2) binding protein	Periplasmic mercury(+2) binding protein
merA	Xylella fastidiosa 9a5c	Xanthomonas axonopodis pv. citri str. 306	Xanthomonas campestris pv. campestris str. ATCC 33913	Stenotrophomonas maltophilia K279a Gene: Smlt2412: Mercuric ion reductase (EC 1.16.1.1)	Mercuric ion reductase (EC 1.16.1.1)

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --