Regulog MerR - Xanthomonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Mercury resistance |
| Effector: | Mercury ion, (Hg2+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Xanthomonadales
- By trascription factor - MerR
- By TF family - MerR
- By effector - Mercury ion, (Hg2+)
- By pathway - Mercury resistance
| Genome | Genes | Operons |
|---|---|---|
| Xylella fastidiosa 9a5c | ||
| Xanthomonas axonopodis pv. citri str. 306 | ||
| Xanthomonas campestris pv. campestris str. ATCC 33913 | ||
| Stenotrophomonas maltophilia K279a | 3 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| merT |
|
|
|
*
Stenotrophomonas maltophilia K279a Site: position = -66 score = 6.35688 sequence = ACTCCGTACTTGACTACGGAAG Gene: Smlt2410: Mercury uptake inner membane protein |
Mercury uptake inner membane protein |
| merP |
|
|
|
Gene: Smlt2411: Periplasmic mercury(+2) binding protein |
Periplasmic mercury(+2) binding protein |
| merA |
|
|
|
Gene: Smlt2412: Mercuric ion reductase (EC 1.16.1.1) |
Mercuric ion reductase (EC 1.16.1.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |