Regulon of MerR in Ralstonia eutropha H16

Properties
Regulator type:	Transcription factor
TF locus tag:	H16_B0903
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Ralstonia
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -142 Score: 6.3 Sequence: ACTCCGTACCTTGGTACGGACC Locus tag: H16_B0904 Name: h16_B0904 Funciton: hypothetical protein Locus tag: H16_B0905 Name: h16_B0905 Funciton: hypothetical protein
	H16_B0904	h16_B0904	hypothetical protein
	H16_B0905	h16_B0905	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD