Regulon of MerR in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	pJP4_53, Reut_D6498
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Mercury resistance
Effector:	Mercury ion, (Hg2+)
Regulog:	MerR - Ralstonia
Statistics of regulated genes:
- Genes	10
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - MerR
By TF family - MerR
By effector - Mercury ion, (Hg2+)
By pathway - Mercury resistance

Regulated operons
	Locus Tag	Name	Function
Position: -63 Score: 6.3 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: Reut_D6497 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: Reut_D6496 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: Reut_D6495 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: Reut_D6494 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: Reut_D6493 Name: merE Funciton: Putative mercury resistance protein
	Reut_D6497	merT	Mercury uptake inner membane protein
	Reut_D6496	merP	Periplasmic mercury (+2) binding protein
	Reut_D6495	merA	Mercuric ion reductase (EC 1.16.1.1)
	Reut_D6494	merD	Mercuric resistance operon coregulator
	Reut_D6493	merE	Putative mercury resistance protein
Position: -63 Score: 6.3 Sequence: ACTCCGTACATGAGTACGGAAG Locus tag: pJP4_52 Name: merT Funciton: Mercury uptake inner membane protein Locus tag: pJP4_51 Name: merP Funciton: Periplasmic mercury (+2) binding protein Locus tag: pJP4_50 Name: merA Funciton: Mercuric ion reductase (EC 1.16.1.1) Locus tag: pJP4_49 Name: merD Funciton: Mercuric resistance operon coregulator Locus tag: pJP4_48 Name: merE Funciton: Putative mercury resistance protein
	pJP4_52	merT	Mercury uptake inner membane protein
	pJP4_51	merP	Periplasmic mercury (+2) binding protein
	pJP4_50	merA	Mercuric ion reductase (EC 1.16.1.1)
	pJP4_49	merD	Mercuric resistance operon coregulator
	pJP4_48	merE	Putative mercury resistance protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD